| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.042675 |
| Chromosome: | chromosome 15 |
| Location: | 337873 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g635800 | SMC1 | Structural Maintenance of Chromosomes protein; (1 of 1) K06636 - structural maintenance of chromosome 1 (SMC1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCAAAAGGACGAGGGGAGAGAGGGGGG |
| Internal bar code: | TCGAATTACCAACCAAGTGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 484 |
| LEAP-Seq percent confirming: | 68.9829 |
| LEAP-Seq n confirming: | 9312 |
| LEAP-Seq n nonconfirming: | 4187 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACATGGATGGAGCAAAGC |
| Suggested primer 2: | GTGTGTGTGTGTGCGTGTGT |