| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.043270 |
| Chromosome: | chromosome 16 |
| Location: | 5203467 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g682950 | RAD9 | DNA damage checkpoint protein; (1 of 1) K10994 - cell cycle checkpoint control protein RAD9A [EC:3.1.11.2] (RAD9A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAGCGATGCAGGGGCGTAGGGCGGTCA |
| Internal bar code: | GTTGGGGGCTTGCGTTGTCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 103 |
| LEAP-Seq percent confirming: | 73.012 |
| LEAP-Seq n confirming: | 303 |
| LEAP-Seq n nonconfirming: | 112 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCATGGAGCAAGGTAAGG |
| Suggested primer 2: | CCACACAGCGAAGAGTGAAA |