Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.044293 |
Chromosome: | chromosome 9 |
Location: | 3012365 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387400 | POLZ1 | DNA polymerase zeta; (1 of 1) K02350 - DNA polymerase zeta (POLZ1, rev3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAACTCGTACAACGCGGGGTGCGGCGGC |
Internal bar code: | CGGACAAGAGGGTCCCACATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1014 |
LEAP-Seq percent confirming: | 93.6947 |
LEAP-Seq n confirming: | 3492 |
LEAP-Seq n nonconfirming: | 235 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGTGTCCGGTGATACAGC |
Suggested primer 2: | TGAAGACTGCACGTTTGAGG |