Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.046439 |
Chromosome: | chromosome 1 |
Location: | 7339273 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g052750 | (1 of 1) PF06011//PF13418 - Transient receptor potential (TRP) ion channel (TRP) // Galactose oxidase, central domain (Kelch_4); Transient receptor potential ion channel | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATCTGCATGTGCCCGTACGACAAGTACA |
Internal bar code: | GGCATATAGTGTCGGGCGAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 718 |
LEAP-Seq percent confirming: | 97.5732 |
LEAP-Seq n confirming: | 2332 |
LEAP-Seq n nonconfirming: | 58 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGTTTAGACCACTCCCCA |
Suggested primer 2: | GCTCAAGTGAGTGAGGGAGG |