| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.048818 |
| Chromosome: | chromosome 3 |
| Location: | 1936818 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g155450 | (1 of 3) PF01167 - Tub family (Tub) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGGGTGGCGTGTTTTGCCCGAGCCCAAA |
| Internal bar code: | GCGGACCACATGTGAAAGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 410 |
| LEAP-Seq percent confirming: | 96.873 |
| LEAP-Seq n confirming: | 1518 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGCATTGGTAGCAGTATT |
| Suggested primer 2: | CCCTTCCAGTATGTCCTCCA |