| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.049290 |
| Chromosome: | chromosome 6 |
| Location: | 1045050 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256350 | (1 of 3) 1.1.2.6 - Polyvinyl alcohol dehydrogenase (cytochrome) / PVADH | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGAGCAACCGCTTTTGGAGCTCCCTGG |
| Internal bar code: | GAATGAGAGGGATGTCCTAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 279 |
| LEAP-Seq percent confirming: | 99.8037 |
| LEAP-Seq n confirming: | 8135 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAACCTCACTGCCTCTGTG |
| Suggested primer 2: | CCTTGCCACCATCGTTAGTT |