Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.049814 |
Chromosome: | chromosome 2 |
Location: | 5888413 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g111450 | TEF4 | (1 of 25) PF00581 - Rhodanese-like domain (Rhodanese); Rhodanese-like protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGATGGAGGGCGGGCCAAAGAGACTATT |
Internal bar code: | CGGAGAGATGGCGTCTCCTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 337 |
LEAP-Seq percent confirming: | 79.3687 |
LEAP-Seq n confirming: | 1031 |
LEAP-Seq n nonconfirming: | 268 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGATACTTGTCGGTGGACG |
Suggested primer 2: | GTGCACAACCATATCAACGC |