| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.051955 |
| Chromosome: | chromosome 7 |
| Location: | 4755648 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g345400 | FAP70 | Flagellar Associated Protein 70; (1 of 1) PTHR23083//PTHR23083:SF418 - TETRATRICOPEPTIDE REPEAT PROTEIN, TPR // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCACACAACCTCCCGCCCCACACGCCCG |
| Internal bar code: | GAGATGGGTATAAAACCTTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 62 |
| LEAP-Seq percent confirming: | 98.7603 |
| LEAP-Seq n confirming: | 239 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAAATGCCTTTCCTCTGC |
| Suggested primer 2: | ACGTACCCACGATTCTGCTC |