| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.052577 |
| Chromosome: | chromosome_13 |
| Location: | 2132999 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre13.g577950 | VPS60 | Subunit of the ESCRT-III complex | sense | 5'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | CCGCCGGTGGTTGAGCGGGCCCCTGAACTT |
| Internal bar code: | CTCGACGTAGGAAGTTTCCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 443 |
| LEAP-Seq percent confirming: | 99.3435 |
| LEAP-Seq n confirming: | 3632 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAACGTACACGGGTTCAG |
| Suggested primer 2: | CCTTGTGCTTGCGTATCAGA |