Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.053096 |
Chromosome: | chromosome 9 |
Location: | 3830001 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g391801 | VSP4 | (1 of 8) PTHR11339:SF290 - PROTEIN T26A8.1; Hydroxyproline-rich cell wall glycoprotein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGAAGACCAGCGGGATGAGCACATTGGG |
Internal bar code: | CCGATGGGCCCGCAAAATTGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 693 |
LEAP-Seq percent confirming: | 98.4038 |
LEAP-Seq n confirming: | 1233 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGATGTAGTTGGCGGTCT |
Suggested primer 2: | AGATTACCACCGGTCTCGTG |