| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.053801 |
| Chromosome: | chromosome 17 |
| Location: | 1773638 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g709350 | SYP5 | Qc-SNARE protein, Syn8/Syntaxin8-family; (1 of 1) K08503 - syntaxin of plants SYP5 (SYP5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGCCTGTGGGCCGGGTACTCTGCGCGT |
| Internal bar code: | GGGCACTCGTTATCATAAGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 860 |
| LEAP-Seq percent confirming: | 91.5789 |
| LEAP-Seq n confirming: | 87 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGAGAAGGCAGAGATGTTC |
| Suggested primer 2: | TGTTTGCTAACACACACGCA |