| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.053982 |
| Chromosome: | chromosome 5 |
| Location: | 3137944 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239250 | (1 of 1) IPR003613//IPR003888//IPR003889//IPR013083 - U box domain // FY-rich, N-terminal // FY-rich, C-terminal // Zinc finger, RING/FYVE/PHD-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTAGGGTACCAAGCCCCCGTCCCGGGTG |
| Internal bar code: | AAGCGCATTCCGTCACGAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 838 |
| LEAP-Seq percent confirming: | 97.2996 |
| LEAP-Seq n confirming: | 3459 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGACCTTCTCGCTTCACA |
| Suggested primer 2: | CCTTCACCAAGAAGTCGCTC |