| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.056697 |
| Chromosome: | chromosome 3 |
| Location: | 1429085 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151250 | LANC1,LAN1 | (1 of 1) PF05147 - Lanthionine synthetase C-like protein (LANC_like); LanC lantibiotic synthetase component C-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCAGCAGCTGCGCGCCTGCCTCACGTG |
| Internal bar code: | GTGTGGGTACCAGGCCGACGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 766 |
| LEAP-Seq percent confirming: | 89.6446 |
| LEAP-Seq n confirming: | 3506 |
| LEAP-Seq n nonconfirming: | 405 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAGTTGTAAGCGGTGTCG |
| Suggested primer 2: | CGTGTGTAACGCTTTGTGCT |