| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.057532 |
| Chromosome: | chromosome 3 |
| Location: | 5762652 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188500 | VPS46 | Subunit of the ESCRT-III complex; (1 of 1) K12197 - charged multivesicular body protein 1 (CHMP1, VPS46, DID2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACTATACCCGCCATGTTCTTCTGGACC |
| Internal bar code: | CCTTCCTAGCTAAGAATTTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 219 |
| LEAP-Seq percent confirming: | 98.5646 |
| LEAP-Seq n confirming: | 206 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACCTAAAGTTCACCGCC |
| Suggested primer 2: | GAGTGTCCAGAACGCACAGA |