| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.057919 |
| Chromosome: | chromosome 3 |
| Location: | 5234390 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182950 | (1 of 1) K12820 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15/PRP43 (DHX15, PRP43) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCGCCCCGCTTGCCAGACCCTCCACCCG |
| Internal bar code: | CAGGTGGGGGGACTGCTCTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 214 |
| LEAP-Seq percent confirming: | 86.8966 |
| LEAP-Seq n confirming: | 126 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTACGGGTGTGAGGTTGC |
| Suggested primer 2: | AAATTTAGAGAAGGCGGGGA |