| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058008 |
| Chromosome: | chromosome 7 |
| Location: | 1668799 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325400 | LEU3 | Isopropylmalate dehydrogenase; (1 of 1) 1.1.1.85 - 3-isopropylmalate dehydrogenase / IMDH | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCTTGGCGTCTGCATGCTGACGCTCG |
| Internal bar code: | GTACCGAACGTGCACGAACGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 124 |
| LEAP-Seq percent confirming: | 3.63771 |
| LEAP-Seq n confirming: | 196 |
| LEAP-Seq n nonconfirming: | 5192 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTCCTTTCCTTTCCTTCC |
| Suggested primer 2: | GCTGCTACCCTCTCCTTCCT |