| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.058741 |
| Chromosome: | chromosome 6 |
| Location: | 104746 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g249750 | (1 of 1) PF07382//PF13374 - Histone H1-like nucleoprotein HC2 (HC2) // Tetratricopeptide repeat (TPR_10) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCATCCTTTGTCACACGGCGCACCACC |
| Internal bar code: | CGGGGGAGGCGGGCTTTGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 208 |
| LEAP-Seq percent confirming: | 94.3719 |
| LEAP-Seq n confirming: | 939 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACTTAGTGGGCGGGCTTT |
| Suggested primer 2: | GGCCTTACTGAACCATTCCA |