Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.059066 |
Chromosome: | chromosome 3 |
Location: | 1896112 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g155001 | ISA1,STA7 | (1 of 1) PTHR10357:SF169 - ISOAMYLASE 1, CHLOROPLASTIC; Isoamylase, starch debranching enzyme 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCTAGCCGCAATCGAGTTGCCGTTCTA |
Internal bar code: | GCGTAAGTAACATGAAACGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 976 |
LEAP-Seq percent confirming: | 99.2328 |
LEAP-Seq n confirming: | 4527 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCGGGATTGTAGACTGGT |
Suggested primer 2: | GTAGCGTCGGTTTTGGTCAT |