| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.059180 |
| Chromosome: | chromosome 2 |
| Location: | 3480451 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095121 | PUS9 | (1 of 1) PTHR21600//PTHR21600:SF11 - RIBOSOMAL LARGE SUBUNIT PSEUDOURIDINE SYNTHASE B // PSEUDOURIDINE SYNTHASE FAMILY PROTEIN; RNA pseudouridine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGAGACACGGGGACACGTAGCACTGGG |
| Internal bar code: | TGCTCGCGAGGGGCCACCGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 98.4643 |
| LEAP-Seq n confirming: | 6091 |
| LEAP-Seq n nonconfirming: | 95 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCATCACAAACGACGGTG |
| Suggested primer 2: | GTATGCGACCCGTTTCTTGT |