Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.059255 |
Chromosome: | chromosome 5 |
Location: | 2254053 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g234663 | SRTC1,SRTC | (1 of 1) PTHR11085:SF23 - NAD-DEPENDENT HISTONE DEACETYLASE HST4; Sir2-like NADH dependent histone deacetylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGTTGCCGCCTGTGCACACGAGACACG |
Internal bar code: | TCTGGTGGTCAACGACATCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 424 |
LEAP-Seq percent confirming: | 99.7087 |
LEAP-Seq n confirming: | 1027 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTACCATCCCATTTCAGC |
Suggested primer 2: | GCTCCATATTTAGCGGCTTG |