| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.060239 |
| Chromosome: | chromosome 3 |
| Location: | 5761927 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188500 | VPS46 | Subunit of the ESCRT-III complex; (1 of 1) K12197 - charged multivesicular body protein 1 (CHMP1, VPS46, DID2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGGTTGAAGATCTGGTCAAGCAGCTTCT |
| Internal bar code: | GAGTTGCGAGGATGGGCCATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 848 |
| LEAP-Seq percent confirming: | 99.2959 |
| LEAP-Seq n confirming: | 4372 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAGAACTTCACGAGGGC |
| Suggested primer 2: | TCCTTCTCGTATAATGCCCG |