| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.060579 |
| Chromosome: | chromosome 13 |
| Location: | 1662221 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574000 | GEF1,CLV1 | Voltage-gated chloride channel; (1 of 1) PTHR11689:SF59 - CHLORIDE TRANSPORT PROTEIN 6 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGGGGTACGCATCGCAGCCGTGGGCGG |
| Internal bar code: | CAAGTTGCCTCGTTAAGGCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 717 |
| LEAP-Seq percent confirming: | 99.5121 |
| LEAP-Seq n confirming: | 6323 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTCCATCCCACTCTTCC |
| Suggested primer 2: | CCTCACGAACATCACACCAC |