| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.062989 |
| Chromosome: | chromosome 16 |
| Location: | 2976712 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g664301 | POLQ1 | DNA polymerase theta; (1 of 2) K02349 - DNA polymerase theta [EC:2.7.7.7] (POLQ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTTCTGGGTGCGGCACTCACTATAGGGT |
| Internal bar code: | ACGTCTGCATGGTAGTGAATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 173 |
| LEAP-Seq percent confirming: | 59.5085 |
| LEAP-Seq n confirming: | 557 |
| LEAP-Seq n nonconfirming: | 379 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAAGGGCGCCTTTTTATAG |
| Suggested primer 2: | GCTGGCACACAAGCAATCTA |