| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.063605 |
| Chromosome: | chromosome 13 |
| Location: | 903206 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567750 | PRP18 | Pre-mRNA splicing factor; (1 of 1) K12817 - pre-mRNA-splicing factor 18 (PRPF18, PRP18) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACCGCTTCCGGGAGAGCAGCCCCAGCC |
| Internal bar code: | TGGGTGGGATAACATCCGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 990 |
| LEAP-Seq percent confirming: | 92.7424 |
| LEAP-Seq n confirming: | 13916 |
| LEAP-Seq n nonconfirming: | 1089 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAACTACCTACATGCCAA |
| Suggested primer 2: | CCTGCAAAGAGCGTACTTCC |