| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.064035 |
| Chromosome: | chromosome 17 |
| Location: | 1272320 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g705450 | LCI26 | Low-CO2-induced U-box protein; (1 of 1) PTHR22849//PTHR22849:SF45 - WDSAM1 PROTEIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCACACGCAGCTCACAAGCGCCGCGGGTG |
| Internal bar code: | GGCAATGACTCCCTTGATACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 791 |
| LEAP-Seq percent confirming: | 94.8487 |
| LEAP-Seq n confirming: | 3259 |
| LEAP-Seq n nonconfirming: | 177 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTACGAATAGGACGGCAA |
| Suggested primer 2: | AAGCCCTACACAACCACAGG |