| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.064974 |
| Chromosome: | chromosome 16 |
| Location: | 3683670 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g688750 | (1 of 1) K13109 - IK cytokine (IK, RED, RER) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCAACACTCGCTGCCGACACTGCCACCC |
| Internal bar code: | CCCTTGTCGCGTCAAGGCACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 456 |
| LEAP-Seq percent confirming: | 99.8645 |
| LEAP-Seq n confirming: | 1474 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAGAGTTCCAGAGGCTGT |
| Suggested primer 2: | CCCTAAACGCCCCTCTAAAC |