Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.065353 |
Chromosome: | chromosome 13 |
Location: | 2213521 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g578501 | (1 of 1) IPR009060//IPR015940//IPR026741//IPR026937//IPR027417 - UBA-like // Ubiquitin-associated domain // Protein strawberry notch // Strawberry notch, helicase C domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAAACATTCAAGAAGATATTTGCAGGT |
Internal bar code: | GGTGTCTTAGGGACATGTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 285 |
LEAP-Seq percent confirming: | 99.6026 |
LEAP-Seq n confirming: | 5264 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCAGGCAAACTCGTGCTA |
Suggested primer 2: | CGAATACCCAATCATCCAGG |