| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066549 |
| Chromosome: | chromosome 14 |
| Location: | 3521520 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630883 | (1 of 2) K03921 - acyl- (DESA1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCTCCCTCCACCCTCGCTCCCTCCCCAC |
| Internal bar code: | CGATCGCGACCAGGAGTGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 344 |
| LEAP-Seq percent confirming: | 71.3751 |
| LEAP-Seq n confirming: | 4578 |
| LEAP-Seq n nonconfirming: | 1836 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCACTCCTCAGACCAAG |
| Suggested primer 2: | AAACACACATGCCTGCACAT |