| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.067475 |
| Chromosome: | chromosome 2 |
| Location: | 6815679 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g119000 | PEX19 | (1 of 1) K13337 - peroxin-19 (PEX19); Putative peroxisome biogenesis protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTTACCTTTTCCCTCGATTATCACACT |
| Internal bar code: | AGAGCACAGAAGAGCGCGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 207 |
| LEAP-Seq percent confirming: | 52.5626 |
| LEAP-Seq n confirming: | 441 |
| LEAP-Seq n nonconfirming: | 398 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGCATATATCCGATGGCT |
| Suggested primer 2: | GACACCGTTTTCATCGTGTG |