| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.068388 |
| Chromosome: | chromosome 3 |
| Location: | 4587109 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176930 | (1 of 4) PF03134 - TB2/DP1, HVA22 family (TB2_DP1_HVA22) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGGGGGCCAGGGGTTTTAGGCGGGACC |
| Internal bar code: | TAGCTTTTTTCTCGCTACACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 249 |
| LEAP-Seq percent confirming: | 99.529 |
| LEAP-Seq n confirming: | 8876 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACGGTCTTCATCATTCT |
| Suggested primer 2: | GCCTACTGGGTAAGCACGAC |