| Insertion cassette: | CIB1 | 
| Side of cassette: | 3' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.068421 | 
| Chromosome: | chromosome 13 | 
| Location: | 1249585 | 
| Confidence (%): | 73 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre13.g570500 | (1 of 2) PF13374//PF13424 - Tetratricopeptide repeat (TPR_10) // Tetratricopeptide repeat (TPR_12) | CDS | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGAAGGCGGAAGCAACCAAGCCGGCG | 
| Internal bar code: | CGTGAAGCGAATGGGAAAAGGC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 902 | 
| LEAP-Seq percent confirming: | 98.9196 | 
| LEAP-Seq n confirming: | 49717 | 
| LEAP-Seq n nonconfirming: | 543 | 
| LEAP-Seq n unique pos: | 154 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCATCAACAACAGCAGCG | 
| Suggested primer 2: | AGGGGTAGAAACAAAGCGGT |