| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.068640 |
| Chromosome: | chromosome 11 |
| Location: | 999755 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467665 | (1 of 1) IPR002909//IPR006626//IPR011050//IPR014756//IPR019316 - IPT domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // Immunoglobulin E-set // G8 domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGACTAACACCAGCGGACTGGTGCTGG |
| Internal bar code: | CGACCTTGTGTCCTGCTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 963 |
| LEAP-Seq percent confirming: | 99.469 |
| LEAP-Seq n confirming: | 1686 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACCAGCAATTCATTGGCA |
| Suggested primer 2: | CCGATACCGCTTTTCACCTA |