| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.069226 |
| Chromosome: | chromosome 4 |
| Location: | 3728697 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229300 | RCA1 | (1 of 4) IPR003959//IPR027417 - ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase; RuBisCO activase 1, chloroplastic | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTATCTAGATGGCTTGCAAGCCGACTAAA |
| Internal bar code: | CGTTAAACCGGTGTGTCGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 910 |
| LEAP-Seq percent confirming: | 99.7059 |
| LEAP-Seq n confirming: | 1356 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCTGATGTCAGCACTACC |
| Suggested primer 2: | AGGAATCCTACCGAGCGTTT |