Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.069707 |
Chromosome: | chromosome 11 |
Location: | 1319888 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467712 | SAGA1 | StArch Granules Abnormal 1; (1 of 3) IPR000104//IPR002044//IPR013784 - Antifreeze protein, type I // Carbohydrate binding module family 20 // Carbohydrate-binding-like fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCTTCTGGCCACCTGACCGACTTCGGT |
Internal bar code: | CGTTGTTTATCTATGGCATGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 97 |
LEAP-Seq percent confirming: | 72.4868 |
LEAP-Seq n confirming: | 137 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTGGAAAGGCACACCTTA |
Suggested primer 2: | GTCGCTCAACTAGGGCTTTG |