Insertion junction: LMJ.RY0402.069874_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.069874
Chromosome:chromosome_1
Location:374271
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g002300 CYN19-2,CYN4 Peptidyl-prolyl cis-trans isomerase, cyclophilin-type antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCACTTCAAGGGCTCCACCTTCCACCGTGT
Internal bar code:TACCAAAGTGTGAAAATTGCTC

Confirmation - LEAP-Seq

LEAP-Seq distance:448
LEAP-Seq percent confirming:99.7498
LEAP-Seq n confirming:5183
LEAP-Seq n nonconfirming:13
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:ACAGCACAGCGACATAGGTG
Suggested primer 2:GCGACCATCATTACAGGCTT