| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.071218 |
| Chromosome: | chromosome 14 |
| Location: | 1100815 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614950 | MRPS2,uS2m | (1 of 1) PF00318//PF01391 - Ribosomal protein S2 (Ribosomal_S2) // Collagen triple helix repeat (20 copies) (Collagen); Mitochondrial ribosomal protein S2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCGCCGCCTCGCGCAGCAGCGGCCGCA |
| Internal bar code: | GGTAATTACCAGGCGTACGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 251 |
| LEAP-Seq percent confirming: | 91.0374 |
| LEAP-Seq n confirming: | 2387 |
| LEAP-Seq n nonconfirming: | 235 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATTGCATTTGGGTTCGGT |
| Suggested primer 2: | GGAGAGGGTGCTCAGATACG |