Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.072149 |
Chromosome: | chromosome 12 |
Location: | 3389614 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g497000 | FAP14 | Flagellar Associated Protein 14; (1 of 1) K15426 - serine/threonine-protein phosphatase 4 regulatory subunit 4 (PPP4R4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGCAGGTTTTCACTGACTCACTGTTCG |
Internal bar code: | TCACCCCAAGGCAAGCAGAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 902 |
LEAP-Seq percent confirming: | 99.5979 |
LEAP-Seq n confirming: | 9165 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCGCTTGCTAGTGCCTCAT |
Suggested primer 2: | GAACTTCCTTGTCCAGCAGC |