| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072165 |
| Chromosome: | chromosome 12 |
| Location: | 4635129 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522950 | MIND1 | Chloroplast septum site-determining protein; (1 of 1) K03609 - septum site-determining protein MinD (minD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGCAACATTCCGCTGCACGCAGGTCAT |
| Internal bar code: | AACAGTCCGGTCTGAACTCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 701 |
| LEAP-Seq percent confirming: | 97.3951 |
| LEAP-Seq n confirming: | 2206 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACACTGTCCTTCCTGGT |
| Suggested primer 2: | GCAGCCAACAACTGATGAGA |