| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.074122 |
| Chromosome: | chromosome 3 |
| Location: | 5040914 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180800 | HDA16 | Histone deacetylase complex protein; (1 of 1) K11644 - paired amphipathic helix protein Sin3a (SIN3A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTTTCGTGCTCTAATGCAGCGAGGTCG |
| Internal bar code: | AAATAGCCTGGGTCTAGTTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 937 |
| LEAP-Seq percent confirming: | 99.4218 |
| LEAP-Seq n confirming: | 9629 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCTCACCATCACACTGG |
| Suggested primer 2: | CTGCGGAAGCTTGCCTATAC |