| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.075648 |
| Chromosome: | chromosome 13 |
| Location: | 1249587 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570500 | (1 of 2) PF13374//PF13424 - Tetratricopeptide repeat (TPR_10) // Tetratricopeptide repeat (TPR_12) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGCGGAAGGCGGAAGCAACCAAGCCGG |
| Internal bar code: | GAGCTCTGTGGCAACGAAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 589 |
| LEAP-Seq percent confirming: | 93.7798 |
| LEAP-Seq n confirming: | 8066 |
| LEAP-Seq n nonconfirming: | 535 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCATCAACAACAGCAGCG |
| Suggested primer 2: | AGGGGTAGAAACAAAGCGGT |