| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.076426 |
| Chromosome: | chromosome 12 |
| Location: | 1361083 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488450 | VSP3 | (1 of 5) PTHR16631:SF9 - GLUCAN 1,3-BETA-GLUCOSIDASE; Hydroxyproline-rich cell wall glycoprotein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCTCGAACCGCTACTACTCGTACTGGT |
| Internal bar code: | GACACGGTGGGCAACATTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 664 |
| LEAP-Seq percent confirming: | 84.6354 |
| LEAP-Seq n confirming: | 2275 |
| LEAP-Seq n nonconfirming: | 413 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGTCAGACATCAGCAGT |
| Suggested primer 2: | CACCGCTCATGTCTTCGTAA |