| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.077097 |
| Chromosome: | chromosome 1 |
| Location: | 3096010 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g019250 | SNE1,GME | GDP-D-mannose 3'%252C5'-epimerase; (1 of 1) 5.1.3.18 - GDP-mannose 3,5-epimerase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGCGTTGCGGTTGGCTTGGCACGCATT |
| Internal bar code: | TGCATCTCGGCCGACCCCCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 383 |
| LEAP-Seq percent confirming: | 99.0401 |
| LEAP-Seq n confirming: | 2270 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTCTCAAGTCTGAGGGTC |
| Suggested primer 2: | CCTCAGTTGCCCTCAGCTAC |