Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.077702 |
Chromosome: | chromosome 10 |
Location: | 2402157 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g435400 | (1 of 1) PF03398 - Regulator of Vps4 activity in the MVB pathway (Ist1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCAAAGCACGAGAGGCCGCGTGTGGAA |
Internal bar code: | TCCGTCGGAGGGGGCTGCCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 681 |
LEAP-Seq percent confirming: | 99.5671 |
LEAP-Seq n confirming: | 1380 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGAGGCAATGCAACTCAA |
Suggested primer 2: | GCTCCAATACAAGGCAAGGA |