| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.077850 |
| Chromosome: | chromosome 9 |
| Location: | 3828527 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391801 | VSP4 | (1 of 8) PTHR11339:SF290 - PROTEIN T26A8.1; Hydroxyproline-rich cell wall glycoprotein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGCCATGAATCCCCGAAAGCACCGACC |
| Internal bar code: | CTGAGACGCAGACTCACATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 97.8255 |
| LEAP-Seq n confirming: | 6928 |
| LEAP-Seq n nonconfirming: | 154 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGAGACCGGTGGTAATCT |
| Suggested primer 2: | GTTTCCTTCTCAGCCAGCAC |