| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.078002 |
| Chromosome: | chromosome 4 |
| Location: | 2446429 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g221550 | CVDE1,NPQ1,FAO5,CVDE,VDE | Chlorophycean Violaxanthin De-epoxidase; (1 of 3) 5.5.1.19 - Lycopene beta-cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGTTCGCGTTTGTTACACACACGGTAG |
| Internal bar code: | GATACCCGAGGGACGAACGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 481 |
| LEAP-Seq percent confirming: | 98.7805 |
| LEAP-Seq n confirming: | 729 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTGGGAATGCTTAGCCTG |
| Suggested primer 2: | TGTTCGCGTACAGGTGAGAG |