| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.078248 |
| Chromosome: | chromosome 12 |
| Location: | 2068624 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509600 | CDD2 | (1 of 1) K15441 - tRNA-specific adenosine deaminase 2 [EC:3.5.4.-] (TAD2, ADAT2); Cytosine deaminase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAGAAATCATTCACTCTTGCTGCGTCTA |
| Internal bar code: | TACTGCGTTTACTAATAGTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 477 |
| LEAP-Seq percent confirming: | 99.7466 |
| LEAP-Seq n confirming: | 5118 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGTCCGAAGTGGAAGTTG |
| Suggested primer 2: | TGAGGGGGAAGATGAAGATG |