| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.079356 |
| Chromosome: | chromosome 12 |
| Location: | 9206687 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541800 | (1 of 2) 3.4.21.26 - Prolyl oligopeptidase / Prolyl endopeptidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAGCATTCCTGCTTTTCCATCCTACCGT |
| Internal bar code: | GATTCCACATTATTCGAGTATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1301 |
| LEAP-Seq percent confirming: | 99.2874 |
| LEAP-Seq n confirming: | 2508 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAACGTAGGGACTGCCAT |
| Suggested primer 2: | AAGACACCTGGAAATGCCAC |