| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.081335 |
| Chromosome: | chromosome 4 |
| Location: | 674591 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217951 | LCI33 | Low-CO2-inducible protein; (1 of 9) IPR011011//IPR013083 - Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGTAGGGCTCAGCAAAGACCTTGATAA |
| Internal bar code: | TTACGCGCGCCCGAAGCACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 411 |
| LEAP-Seq percent confirming: | 73.0847 |
| LEAP-Seq n confirming: | 1803 |
| LEAP-Seq n nonconfirming: | 664 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACAGCCTGGACAACAGAG |
| Suggested primer 2: | CTACTTCAAGCAAGGGCCTG |