| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.081976 |
| Chromosome: | chromosome 16 |
| Location: | 4029631 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670250 | TOM6 | (1 of 1) K14964 - Set1/Ash2 histone methyltransferase complex subunit ASH2 (ASH2); Translocase of mitochondrial outer membrane | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTACAATTAAAGCCCACTGCTCATGAACT |
| Internal bar code: | TTTGTACTTGATTACCAGAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 90 |
| LEAP-Seq percent confirming: | 92.2222 |
| LEAP-Seq n confirming: | 83 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAACGAGGGCACGTACT |
| Suggested primer 2: | GGCTGTTTCATGGGTTAGGA |