| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.083752 |
| Chromosome: | chromosome 3 |
| Location: | 1426545 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151200 | CGLD16 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR36343:SF1 - EXPRESSED PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACTTGAAATGCAGTCACACGAAGCCAGG |
| Internal bar code: | CCTTTTTGCCTCGCCTTCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 174 |
| LEAP-Seq percent confirming: | 99.5459 |
| LEAP-Seq n confirming: | 3946 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATTGACAGTTCAGCGAAA |
| Suggested primer 2: | ACGGACAGGTCAATGTAGCC |